Skip to main content

Table 1 Primer sequences and amplicon size for RET, PAX and ALDH1A2 gene with SNP position.

From: Evaluation of High Resolution Melting analysis as an alternate tool to screen for risk alleles associated with small kidneys in Indian newborns

Gene Forward/Reverse primer Product size (bp) SNP position in the amplicon (from 5'end)
RET ATCGGGAAAGTCTGTGTGGA
CCTAGCGTGCTGCAGTTGGCA
95 33
PAX2 GCCCCTTTGTCAACTTTGAGAGCCC
TGCCAACCTTGAATTCCTCAAGCA
122 70
ALDH1A2 TGGGTGGAGAGCAAAAGAGAGCA
GTAGCCTCCCCCGTGCCTGA
124 57