Skip to main content

Table 1 Primers used for qRT-PCR

From: Renal neutrophil gelatinase associated lipocalin expression in lipopolysaccharide-induced acute kidney injury in the rat

Gene Sense Anti-sense
TNFα TACTCCCAGGTTCTCTTCAAGG GGAGGTTGACTTTCTCCTGGTA
IL-6 TCCTTTGAACTCTACAAGGACC GTATCCACCATTATGCCCAGCC
NGAL GATGTTGTTATCCTTGAGGCCC CACTGACTACGACCAGTTTGCC
GAPDH GGCATGGACTGTGGTCATGA TTCACCACCATGGA GAAGGC
  1. Abbreviations: NGAL, neutrophil gelatinase associated lipocalin; TNFα, tumor necrosis factor α; IL-6, interleukin 6; GAPDH as a housekeeping gene.