Skip to main content

Table 2 Details of primer and probe sequences

From: Potential diagnostic biomarkers for chronic kidney disease of unknown etiology (CKDu) in Sri Lanka: a pilot study

Name Accession Number Sequences 5’–3’
(F- forward, R- reverse, P- probe)
GCLC NM_001498.3 F: ACAAGGACGTTCTCAAGTG
R: AGGATGGTTTGGGTTTGTC
P: CCTGTCTGGGGAGAAAGTTCTTGAAACTCT
KIM1 NM_012206.2 F: AACCAGTAGCCACTTCAC
R: CTGTCACGGTGTCATTCC
P: TCAGCCAGCAGAAACCCACCC
GSTM1 NM_000561.3 F: GCATGATCTGCTACAATCCA
R: TTGTTTCCTGCAAACCAT
P: CCTGAAAAGCTAAAGCTCTACTCAGAG
KLK1 NM_002257.3 F: GGACTACAGCCACGACCTCATGCTGC
R: GTCCACACACTGGAGATCATCTGG
P: TGGAGTTGCCCACCGAGGAACCCGAA
CYP2D6 NM_000106.5 F: TAGTGGTGGCTGACCTGTTCTCT R: TCGTCGATCTCCTGTTGGACA P: CTCCTGCTCATGATCCTACATCCGGA
CYP2C19 NM_000769.1 F: GAACACCAAGAATCGATGGACA
R: TCAGCAGGAGAAGGAGAGCATA
P: TAATCACTGCAGCTGACTTACTTGGAGCTGGG
IGFBP1 NM_000596.2 F: GGGACGCCATCAGTACC R: CCATTTTTTGATGTTGGTGAC P: ATGATGGCTCGAAGGCTCTCCA
IGFBP3 NM_000598.4 F: CAGAGCACAGATACCCAGAACTTC R: TTCTCTACGGCAGGGACCAT P: ATTCTGTCTCCCGCTTGGACTCGGA
FN1 NM_212482.1 F: GAAGAGCGAGCCCCTGAT R: GGGGTCTTTTGAACTGTGGA P: AGACGAGCTTCCCCAACTGGTAACCCCTT
G6PD NM_000402.4 F: TGCCCCCGACCGTCTAC R: ATGCGGTTCCAGCCTATCTG P: ACTCGTGAATGTTCTTGGTGACGGCC
B2M NM_004048.2 F: TGCCGTGTGAACCATGTGA R: CCAAATGCGGCATCTTCAA P: TGATGCTGCTTACATGTCTCGATCCCACT
GAPDH NM_001289745.1 F: TGACCTCAACTACATGGTTTA
R: GCCCCACTTGATTTTGGA
P: CCATGGCACCGTCAAGGCTGA