Skip to main content

Advertisement

Table 1 Primers used in this study

From: Protective effect of rutin supplementation against cisplatin-induced Nephrotoxicity in rats

Gene Name Forward primer Reverse primer
JNK 5′-AAATAGAGCATCCCAGTCTTCGA-3′ 5′-ACTGGGCCGCTGTTTCTG-3′
MKK4 5′- CATCGGGCCTCCAGCTT -3′ 5′- AAATTCAACTTCAGGGCTTTGC -3′
MKK7 5′- AAGCTCTGTGACTTTGGCATCA -3′ 5′- CAGCCAGCACTCCGTGTTT -3′
P38 5′-GGTTTTGGACTCGGATAAGAGGAT-3’ 5′-GGGTCGTGGTACTGAGCAAAG-3’
TRAF2 5′-ACGCTGCCCGCAGAGA-3’ 5′-TCTTTCAAGGTCCCCTTCCA-3’
TNF-α 5′-CGGGCTCAGAATTTCCAACA-3’ 5′-CGCAATCCAGGCCACTACTT-3’
IL-1-α 5′-CATCCGTGGAGCTCTCTTTACA-3’ 5′-TTAAATGAACGAAGTGAACAGTACAGATT-3’
GAPDH 5′-AACTCCCATTCCTCCACCTT-3’ 5′-GAGGGCCTCTCTCTTGCTCT-3’