Skip to main content

Table 1 Primer sequence in this study

From: Contiguous 22.1-kb deletion embracing AVPR2 and ARHGAP4 genes at novel breakpoints leads to nephrogenic diabetes insipidus in a Chinese pedigree

Genes Oligonucleotide Sequence
AVPR2-E1 Upper primer 5′ gggggatcctgggttctgtgc 3’
Lower primer 5′ cccaggctcatgcagtccagaag 3’
AVPR2-E2A Upper primer 5′ ctgcatgagcctggggtgtgtatc 3’
Lower primer 5′ cgcaaagcaggcccagcagtc 3’
AVPR2-E2B Upper primer 5′ accgccaccgtgccatctg 3’
Lower primer 5′ ggccagcaacatgagtagcacaaag 3’
AVPR2-E3 Upper primer 5′ tggccaagactgtgaggatgac 3’
Lower primer 5′ cccctcctacacccagctcag 3’
P1 Upper primer 5′ gggcccttcctccagattcttc 3’
Lower primer 5′ gggcgaggaatccatgctaacc 3’
P2 Upper primer 5′ ctgccacacacccactctcac 3’
Lower primer 5′ tggcagatgaggacgtgacag 3’
P3 Upper primer 5′ tccccaaaccaaagatattacag 3’
Lower primer 5′ cggggtttcttcatgttgg 3’
P4 Upper primer 5′ cacgcataaccacatcactgaa 3’
Lower primer 5′ gggcgagatattgagagcttc 3’
P5 Upper primer 5′ cccaaacagcccactaacagcaact 3’
Lower primer 5′ cggggggtagaaggagggtgag 3’
P6 Upper primer 5′ cccgcactgtaggattccactc 3’
Lower primer 5′ ggattgcaggtgtgagccagtc 3’
P7 Upper primer 5′ ggcgcagaggagaaggttgac 3’
Lower primer 5′ cgcttccctgcatcttgttctc 3’
P8 Upper primer 5′ gcccctaggtgcgtgcttctc 3’
Lower primer 5′ ggtggggagcaggcagagc 3’
P9 Upper primer 5′ tggcccagtttaacattttttgata 3’
Lower primer 5′ cccggatctggactaggacatg 3’
qGAPDH Upper primer 5′ gcgctgagtacgtcgtggagtc 3’
Lower primer 5′ gagcctacagcagagaagcagacag 3’
qAVPR2 Upper primer 5′ gggccttctcgctccttct 3’
Lower primer 5′ agggcaatccaggtgacatag 3’