Skip to main content

Advertisement

Table 1 The sequences of primers used for RT-PCR and NGAL siRNA

From: NGAL protects against endotoxin-induced renal tubular cell damage by suppressing apoptosis

gene sequence product(bp)
NGAL TTGGGACAGGGAAGACGA 240
TCACGCTGGGCAACATTA
Caspase3 GTTCATCCAGTCGCTTTGTGC 110
AAATTCTGTTGCCACCTTTCG
β-actin TCGCGGGAGACCACCGACAC 258
GGGGTGTTGGGTCAGGTCTCTG
siRNA UUUAGUUCCGAAGUCAGCUCCUUGG  
CCAAGGAGCUGACUUCGGAACUAAA