Skip to main content

Table 2 Quantitative polymerase chain reaction primer sequences

From: The two isoforms of matrix metalloproteinase- 2 have distinct renal spatial and temporal distributions in murine models of types 1 and 2 diabetes mellitus

Genes Forward (5’➔3′) Reverse (5’➔3′)
Full length MMP-2 (mouse) GACCTCTGCGGGTTCTCTGC TTGCAACTCTCCTTGGGGCAGC
N-terminal truncated MMP-2 (mouse) GTGAATCACCCCACTGGTGGGTG TTGCAACTCTCCTTGGGGCAGC
β-actin (mouse control) CTCTCTTCCAGCCTTCCTTCC CTCCTTCTGCATCCTGTCAGC
\