Skip to main content

Table 1 Primers used for Sanger sequencing of the coding sequences and exon-intron boundaries of the SLC7A13 gene

From: No evidence for point mutations in the novel renal cystine transporter AGT1/SLC7A13 contributing to the etiology of cystinuria

Exon Foward Primer Reverse Primer Length of PCR product
1 SLC7A13_1.1F: CTTTGCAGCTACATAGGCAGG
SLC7A13_1.2F: TGGACATCCTTGTTTCTGGGG
SLC7A13_1.1R: TAGGCAGCTTTGGGACAGAG
SLC7A13_1.2R: GGCTGGCATGATCTGATTCAG
471
537
2 SLC7A13_2F: TAAAATCATGCTTGTACCCC SLC7A13_2R: AACAGTGGTTCTGACTGGTG 330
3 SLC7A13_3F: TCATTAGTATTTCTCTTTTAACAC SLC7A13_3R: TGTGTTTCACAGTAACTGAG 541
4 SLC7A13_4F: TGCAGGTATCATTCATGGATGTTC SLC7A13_4R: TGTTTAACCTTGATTTGGAATCTG 367