Skip to main content

Table 1 Primers used for gene expression analyses

From: Bone marrow mesenchymal stem cells attenuate the progression of focal segmental glomerulosclerosis in rat models

Primer Name Sequence (5′ to 3′) Application
Rat-IL-6-F CCTTCTTGGGACTGATGT Real-time RT-PCR
Rat-IL-6-R TCCAGGTAGAAACGGAAC Real-time RT-PCR
Rat-TNF-α-F GGCGTGTTCATCCGTTCT Real-time RT-PCR
Rat-TNF-α-R CCACTACTTCAGCGTCTCG Real-time RT-PCR
Rat-GAPDH-F ACCACAGTCCATGCCATCAC Real-time RT-PCR
Rat-GAPDH-R TCCACCACCCTGTTGCTGTA Real-time RT-PCR