Table 1 Primers used for pcr amplification of kcnj1
From: A novel mutation of KCNJ1 identified in an affected child with nephrolithiasis
Primer | Primer sequence | Location | Mutation site | Fragment size (bp) | SIFT | Polyphen-2 | MutationTaster | REF |
|---|---|---|---|---|---|---|---|---|
F | CGCTACTGCATACCACAGGAG | Exon 4 | c.89G > A | 400 | 0 | 0.999 | 1 | Schulte et al. 1999 |
R | TGCCAAATGATTAGTAACCCAG | c.65G > T | 0 | 0.998 | 1 | Novel |