Skip to main content

Table 1 Primers used for pcr amplification of kcnj1

From: A novel mutation of KCNJ1 identified in an affected child with nephrolithiasis

Primer Primer sequence Location Mutation site Fragment size (bp) SIFT Polyphen-2 MutationTaster REF
F CGCTACTGCATACCACAGGAG Exon 4 c.89G > A 400 0 0.999 1 Schulte et al. 1999
R TGCCAAATGATTAGTAACCCAG   c.65G > T   0 0.998 1 Novel