Skip to main content

Table 2 The results of the next-generation sequencing of the patient

From: Urinary coenzyme Q10 as a diagnostic biomarker and predictor of remission in a patient with ADCK4-associated Glomerulopathy: a case report

Variant gene Location Transcriptional exons Nucleotide amino acids Homozygous /heterozygous Prevalence in Control population Analysis of pathogenicity Phenotype of mutation Source
COL43A chr2–228,144,556 NM-000091; exon29 c.2173A > G (p.K725E) Het Not reported Uncertain Alport syndrome; familial hematuria Father
COQ8B chr19–41,209,508 NM-024876; exon9 c.737G > A (p.S246N) Het 0.00435 Uncertain Type 9 nephrotic syndrome Father
COQ8B chr19–41,209,736-41,209,778 NM-024876; exon8 c.577-600del (p.193-200del) Het Not reported Uncertain Type 9 nephrotic syndrome Mother
  1. Sequencing analysis of the patient demonstrating the detection of c.737G > A (p.S246N) mutation in exon 9 and c.577-600del AGAGTTCTTGAAGAGGAGCTCGGC (p.193-200del) in exon 8 of the COQ8B gene